Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting
DOI:
https://doi.org/10.1590/S1678-3921.pab2000.v35.5989Keywords:
breeding methods, molecular cloning, progeny testing, horses, identification, genetic polymorphismAbstract
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.Downloads
Published
2000-10-01
How to Cite
Anunciação, C. E., & Filho, S. A. (2000). Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting. Pesquisa Agropecuaria Brasileira, 35(10), 2007–2015. https://doi.org/10.1590/S1678-3921.pab2000.v35.5989
Issue
Section
GENETICS
